issues Search Results · repo:s-andrews/FastQC language:Java
Filter by
134 results
(76 ms)134 results
ins-andrews/FastQC (press backspace or delete to remove)Hello
I noticed that a recent version of fastqc, FastQC v0.12.1, leaves fastq files on disk when given fastq.gz files in
input, while it was not the case for a previous version (FastQC v0.11.8) :
Using ...
aduclert
- 10
- Opened 7 days ago
- #150
After removing rRNA with bowtie2 bowtie2 -p 8 -x ${RRNA_INDEX}/hg38_rRNA --very-sensitive -1 $R1_FILE -2 $R2_FILE
--un-conc-gz ${OUTDIR}/${SAMPLE}.no_rRNA.fastq.gz -S ${RRNA_PATH}/${SAMPLE}.rRNA.sam ...
MR-D-CJ
- 1
- Opened 11 days ago
- #149
Hi @s-andrews ,
We have been seeing unequal duplication level at multiple stages. Paired end data for each sample was concatenated from
two runs. Some FastQC results (via MultiQC):
1. Raw reads concatenated: ...
oskesr
- 2
- Opened 11 days ago
- #148
Hi @s-andrews,
I have a scenario where, I have few thousand reads for which the base quality is =30 for all the bases in the reads.
Majority of the reads have qual 34. When I run through FastQC, the report ...
rjg2186
- 1
- Opened on Feb 7
- #147
Hi there,
Thanks for the tool.
I have some paired-end bulkRNAseq. I ran fastp as below with --trim_poly_g but in the FASTQC report for a sample, there
was still shown issue with over-represented sequence ...
denvercal1234GitHub
- 1
- Opened on Dec 14, 2024
- #146
If you specify --dup_length and the value you give is longer than any of the reads in your fastq file then fastqc will
crash.
It would be better to just take as many bases as it can up to that length ...
s-andrews
- Opened on Nov 21, 2024
- #145
If you give fastqc 2 adapters to search: adapter1: AATTAATTAATT (width = 12) adapter2: AAATTTGGGAAAAAATTTGGGAAA
(width=24=max_adapter_size)
Let us say all reads in the fastq file are 51nt long:
Fastqc ...
Roleren
- Opened on Nov 7, 2024
- #144
Hello Andrews, I have downloaded the latest version of fastqc windows version as zip file and extracted it. I am able to
access fastqc from git bash. But unable to open Fastqc in cmd.
1) I have added ...
karthi-ntu
- 2
- Opened on Nov 7, 2024
- #143
Hi,
I am trying to run fastqc from within a singularity container, and I get the specified error message. I have tried
different solutions on stack exchange about exporting the DISPLAY variable, but nothing ...
hbhutta
- 2
- Opened on Oct 18, 2024
- #142
With FastQC v0.12.1 (bioconda hdfd78af_0) on RHEL 9.4, we re seeing a discrepancy when using the -d and --dir flags to
specify a non-standard directory for temporary files
$ fastqc -d /test/temp file.fastq.gz ...
rzelle-lallemand
- 1
- Opened on Oct 17, 2024
- #141
Learn how you can use GitHub Issues to plan and track your work.
Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub IssuesProTip!
Press the /
key to activate the search input again and adjust your query.Learn how you can use GitHub Issues to plan and track your work.
Save views for sprints, backlogs, teams, or releases. Rank, sort, and filter issues to suit the occasion. The possibilities are endless.Learn more about GitHub IssuesProTip!
Restrict your search to the title by using the in:title qualifier.