AttributeError: 'array.array' object has no attribute 'tostring'

[oliverartz]

Dear developer,

I have been trying to simulate some in silico tumors using BAMSurgeon. After installing (check_dependencies.py not throwing any errors) and generating random sites using randomsites.py, I tried introducing SNVs with addsnv.py. I am running the following command

python3 -O /home/artzo/bin/bamsurgeon/bin/addsnv.py \
-v random_SNV_1k.txt \
-f [BAM FILE] \
-r [GENOME FILE] \
-o [OUTPUT FILE] \
--aligner mem \
--picardjar [PATH TO PICARD.JAR] \
--tagreads \
--seed 2010 \
-p 12 \
--insane 

I redacted the file paths in the above command. I got some errors regarding sanity checks, so I decided to use --insane. The script runs for about 20 min generating temporary files and a surprisingly small output BAM. The error.log is rather lengthy (>75k lines) and ends with

INFO 2022-06-20 14:41:34,076 loading donor reads into dictionary...

INFO 2022-06-20 14:41:34,774 secondary reads count:0
INFO 2022-06-20 14:41:34,774 supplementary reads count:0
INFO 2022-06-20 14:41:34,774 loaded 229926 reads, (144 excluded, 0 null or secondary or supplementary--> ignored)

Traceback (most recent call last):
  File "/home/artzo/bin/bamsurgeon/bin/addsnv.py", line 479, in <module>
    run()
  File "/home/artzo/bin/bamsurgeon/bin/addsnv.py", line 476, in run
    main(args)
  File "/home/artzo/bin/bamsurgeon/bin/addsnv.py", line 422, in main
    rr.replace_reads(args.bamFileName, outbam_mutsfile, args.outBamFile, keepqual=True, seed=args.seed)
  File "/lila/home/artzo/bin/bamsurgeon/bin/bamsurgeon/replace_reads.py", line 165, in replace_reads
    rdict[extqname].qual = read.qual
  File "pysam/calignedsegment.pyx", line 2182, in pysam.calignedsegment.AlignedSegment.qual.__get__
  File "pysam/cutils.pyx", line 45, in pysam.cutils.array_to_qualitystring
AttributeError: 'array.array' object has no attribute 'tostring'

I have read that the tostring issue might be due to incompatibilities with Python 3.9 (which I am using). However, tostring was deprecated in Python 3.2 and I find it hard to believe that all other users are using Python < 3.2. So, I was wondering whether a different issue might be at play here. I would greatly appreciate your help!

Thank you very much for the development and support of BAMSurgeon!
Best,
Oliver

[oliverartz]

I do seem to get a similar error running the test dataset.

python3 -O bin/addsv.py \
-p 1 \
-v test_data/test_sv.txt \
-f test_data/testregion_realign.bam \
-r test_data/Homo_sapiens_chr22_assembly19.fasta \
-o test_data/testregion_sv_mut.bam \
--aligner mem \
--keepsecondary \
--seed 1234 \
--inslib test_data/test_inslib.fa

Results in

INFO 2022-06-21 12:11:49,433 starting bin/addsv.py called with args: bin/addsv.py -p 1 -v test_data/test_sv.txt -f test_data/testregion_realign.bam -r test_data/Homo_sapiens_chr22_assembly19.fasta -o test_data/testregion_sv_mut.bam --aligner mem --keepsecondary --seed 1234 --inslib test_data/test_inslib.fa
INFO 2022-06-21 12:11:49,435 loading insertion library from test_data/test_inslib.fa
WARNING 2022-06-21 12:11:49,452 22 33871043 33884754 DEL 0.75 is over 10kbp long: converting to use BIGDEL instead.
WARNING 2022-06-21 12:11:49,452 22 34071043 34084754 INV 0.5 is over 10kbp long: converting to use BIGINV instead.
WARNING 2022-06-21 12:11:49,452 22 34271043 34284754 DUP 3 0.9 is over 10kbp long: converting to use BIGDUP instead.
WARNING 2022-06-21 12:11:49,453 22 34271043 34284754 DUP 0.9: using BIGDUP requires specifying a --donorbam and none was provided, using test_data/testregion_realign.bam
INFO 2022-06-21 12:11:49,538 22_33609508_33611508_INS interval: 22 33609508 33611508 INS INSLIB:10_9258941_9259251_AluYa5_+ 8
INFO 2022-06-21 12:11:49,538 22_33609508_33611508_INS length: 2000
INFO 2022-06-21 12:11:49,543 22_33609508_33611508_INS discordant fraction: 0.000000
concurrent.futures.process._RemoteTraceback:
"""
Traceback (most recent call last):
  File "/home/artzo/miniconda3/lib/python3.9/concurrent/futures/process.py", line 243, in _process_worker
    r = call_item.fn(*call_item.args, **call_item.kwargs)
  File "/lila/home/artzo/bin/bamsurgeon/bin/addsv.py", line 416, in makemut
    contigs = ar.asm(chrom, start, end, args.bamFileName, reffile, int(args.kmersize), args.tmpdir, mutid=mutid, debug=args.debug)
  File "/lila/home/artzo/bin/bamsurgeon/bin/bamsurgeon/asmregion.py", line 193, in asm
    rquals.append(mate.qual)
  File "pysam/calignedsegment.pyx", line 2182, in pysam.calignedsegment.AlignedSegment.qual.__get__
  File "pysam/cutils.pyx", line 45, in pysam.cutils.array_to_qualitystring
AttributeError: 'array.array' object has no attribute 'tostring'
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
  File "/lila/home/artzo/bin/bamsurgeon/bin/addsv.py", line 1129, in <module>
    main(args)
  File "/lila/home/artzo/bin/bamsurgeon/bin/addsv.py", line 957, in main
    tmpbam, exclfn, mutinfo = result.result()
  File "/home/artzo/miniconda3/lib/python3.9/concurrent/futures/_base.py", line 446, in result
    return self.__get_result()
  File "/home/artzo/miniconda3/lib/python3.9/concurrent/futures/_base.py", line 391, in __get_result
    raise self._exception
AttributeError: 'array.array' object has no attribute 'tostring'
INFO 2022-06-21 12:11:49,561 22_34171055_34173700_INS interval: 22 34171055 34173700 INS ACTAACCTGCACAATGTGCACATGTACCCTAAAACTTAGAGTATAATAAAAAAAA 13 AA^TTTT 0.8
INFO 2022-06-21 12:11:49,562 22_34171055_34173700_INS length: 2645
INFO 2022-06-21 12:11:49,568 22_34171055_34173700_INS discordant fraction: 0.000000
INFO 2022-06-21 12:11:49,580 22_33607508_33607508_TRN interval: 22 33607508 33607508 TRN 22 34314981 34314981 ++ 1.0
INFO 2022-06-21 12:11:49,581 22_33607508_33607508_TRN length: 8000
INFO 2022-06-21 12:11:49,584 22_33607508_33607508_TRN discordant fraction: 0.000000
INFO 2022-06-21 12:11:49,593 22_33871043_33871043_BIGDEL interval: 22 33871043 33871043 BIGDEL 22 33884754 33884754 ++ 0.750000
INFO 2022-06-21 12:11:49,593 22_33871043_33871043_BIGDEL length: 8000
INFO 2022-06-21 12:11:49,597 22_33871043_33871043_BIGDEL discordant fraction: 0.000000
INFO 2022-06-21 12:11:49,608 22_33891043_33891043_BIGDEL interval: 22 33891043 33891043 BIGDEL 22 33902689 33902689 ++ 0.500000
INFO 2022-06-21 12:11:49,608 22_33891043_33891043_BIGDEL length: 8000
INFO 2022-06-21 12:11:49,613 22_33891043_33891043_BIGDEL discordant fraction: 0.000000
INFO 2022-06-21 12:11:49,627 22_34071043_34071043_BIGINV interval: 22 34071043 34071043 BIGINV 22 34084754 34084754 +- 0.500000
INFO 2022-06-21 12:11:49,627 22_34071043_34071043_BIGINV length: 8000
INFO 2022-06-21 12:11:49,632 22_34071043_34071043_BIGINV discordant fraction: 0.000000
INFO 2022-06-21 12:11:49,646 22_34071043_34071043_BIGINV interval: 22 34071043 34071043 BIGINV 22 34084754 34084754 -+ 0.500000
INFO 2022-06-21 12:11:49,646 22_34071043_34071043_BIGINV length: 8000
INFO 2022-06-21 12:11:49,651 22_34071043_34071043_BIGINV discordant fraction: 0.000000
INFO 2022-06-21 12:11:49,669 22_34284754_34284754_BIGDUP interval: 22 34284754 34284754 BIGDUP 22 34271043 34271043 ++ 1.000000
INFO 2022-06-21 12:11:49,669 22_34284754_34284754_BIGDUP length: 8000
INFO 2022-06-21 12:11:49,674 22_34284754_34284754_BIGDUP discordant fraction: 0.000000

Again, I am seeing the tostring issue popping up. I feel like I am missing something obvious since the issue was not reported before. Thanks for your help!

Oliver

[ZSJSL]

Did you solve your problem? I had the same problem

[adamewing]

Hi, sorry for the delay. My initial suspicion is that this is an issue with pysam - could you let me know which version of pysam you are using (echo "import pysam; print(pysam.__version__)" | python) and which version of python (appears to be 3.9 but please double check). Thanks.

[oliverartz]

Thanks for getting back to me.
python3 --version prints Python 3.9.12
echo "import pysam; print(pysam.__version__)" | python prints 0.9.1.
I have tried updating pysam using conda and mamba (following instructions on https://pysam.readthedocs.io/en/latest/installation.html), but that didn't solve it.

[Rapsssito]

@oliverartz, I strongly recommend that you update pysam to at least version 0.18.0. It should fix your issue.